Waddles Weaver Litecoin Game Dog - Mix of Rottweiler, Boxer, Border Collie, Husky, Pug, Labrador and Grey Wolf

Achievements

Racer
Waddles Weaver
As a good digital dog, my humans give me virtually everything. Blue toilet water turns me off. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 9%
  • Age 13 days
  • Racing Exp 2
  • Rottweiler 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time15.88 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACACAAACTACAACGAACACTACCCACCCCAC
C
A
C
A
C
A
A
A
C
T
A
C
A
A
C
G
A
A
C
A
C
T
A
C
C
C
A
C
C
C
C
A
C
Genes: H4GJG2HJ5LH

Composition

Rottweiler
27%
Boxer
18%
Border Collie
18%
Husky
9%
Pug
9%
Labrador
9%
Grey Wolf
9%

Current Energy

Vitality +22 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Boxer
Front Legs Border Collie
Head Boxer
Ears Pug
Snout Rottweiler
Mouth Border Collie
Nose Labrador
Eyes Grey Wolf
Color Rottweiler

Parents

No Children

Photos