Tabetha Tails Litecoin Game Dog - Mix of Border Collie, Husky, Pug, German Shepard, Schnauzer, French Bulldog and Labrador BK

Achievements

None
Tabetha Tails
Hey! Call me Tabetha Tails. I'm a super-dog in the internet universe. Small yappy creatures bug me...they disturb my zen. I cry whenever I hear an ambulance siren! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 13%
  • Age 15 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATACTACTCATACATACGAGAAGAAGCAACA
A
C
A
T
A
C
T
A
C
T
C
A
T
A
C
A
T
A
C
G
A
G
A
A
G
A
A
G
C
A
A
C
A
Genes: 4JJ7JC92264

Composition

Border Collie
27%
Husky
18%
Pug
18%
German Shepard
9%
Schnauzer
9%
French Bulldog
9%
Labrador BK
9%

Current Energy

Vitality +66 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Border Collie
Legs Border Collie
Front Legs German Shepard
Head Border Collie
Ears Schnauzer
Snout French Bulldog
Mouth Pug
Nose Pug
Eyes Labrador BK
Color Husky

Parents

No Children