Babykins Beans Litecoin Game Dog - Mix of Maltese, Grey Wolf, Beagle, German Shepard, Rottweiler, Husky, Dachshund and Border Collie

Achievements

None
Babykins Beans
They call me Babykins Beans. What's your name? As a good digital dog, my humans give me virtually everything. When I hook up, I stay hooked up for about 20 minutes. I'm totally against baths! They are the worst! The place I like most in the world is curled up in my human's bed, hogging all the covers!
  • Purity 6%
  • Age 16 days
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCTAACCTCAACCCCCCACACAGGATACACC
C
C
C
C
T
A
A
C
C
T
C
A
A
C
C
C
C
C
C
A
C
A
C
A
G
G
A
T
A
C
A
C
C
Genes: LDK7KLH4AJK

Composition

Maltese
27%
Grey Wolf
18%
Beagle
9%
German Shepard
9%
Rottweiler
9%
Husky
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality +29 points
Lunar Effect +10 points

Traits Breakdown

Body Grey Wolf
Tail Beagle
Legs Maltese
Front Legs German Shepard
Head Maltese
Ears Grey Wolf
Snout Rottweiler
Mouth Husky
Nose Dachshund
Eyes Border Collie
Color Maltese