Rowdy Rex Litecoin Dog - Mix of Pug, Labrador BK, Labrador, Beagle, Corgi, Husky, Schnauzer and Shiba Inu

Achievements

None
Rowdy Rex
I answer to 'Rowdy Rex'. Here in cyberspace, I ain't got much use for a floppy disc. I hate having to wear foo-foo clothes and ribbons in my fur. I believe running along the beach to catch a stick can be nearly orgasmic. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!
  • Purity 8%
  • Age 5 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGCACTAAGCACAATAGTACCACCAGCAGAA
G
A
A
G
C
A
C
T
A
A
G
C
A
C
A
A
T
A
G
T
A
C
C
A
C
C
A
G
C
A
G
A
A
Genes: 26DO4CE5562

Composition

Pug
18%
Labrador BK
18%
Labrador
18%
Beagle
9%
Corgi
9%
Husky
9%
Schnauzer
9%
Shiba Inu
9%

Current Energy

Vitality -55 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Labrador BK
Legs Beagle
Front Legs Corgi
Head Husky
Ears Schnauzer
Snout Shiba Inu
Mouth Labrador
Nose Labrador
Eyes Labrador BK
Color Pug