Muggles Mohawk Digital Cryptocurrency Game Dog - Mix of German Shepard, Beagle, Labrador BK, Yorkshire Terrier, Pug, Golder Retriever, Dachshund and Corgi

Achievements

None
Muggles Mohawk
I live inside of a web app in a big data center. Don't bother contacting me if you like cats. I love unconditionally. Removing excess stuffing from pillows is my favorite hobby. I've been known to run with bad dogs.
  • Purity 6%
  • Age 18 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCACTAGCACTATTAGAAAGATCAGGATCAAGC
T
C
A
C
T
A
G
C
A
C
T
A
T
T
A
G
A
A
A
G
A
T
C
A
G
G
A
T
C
A
A
G
C
Genes: 7D6DF287A7O

Composition

German Shepard
27%
Beagle
18%
Labrador BK
9%
Yorkshire Terrier
9%
Pug
9%
Golder Retriever
9%
Dachshund
9%
Corgi
9%

Current Energy

Vitality +24 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Labrador BK
Front Legs Beagle
Head Yorkshire Terrier
Ears Pug
Snout Golder Retriever
Mouth German Shepard
Nose Dachshund
Eyes German Shepard
Color Corgi