Buddie Benny Digital Cryptocurrency Dog - Mix of Labrador BK, Grey Wolf, Labrador, Poodle, Maltese, Husky, German Shepard, St. Bernard, Golder Retriever and Rottweiler

Achievements

None
Buddie Benny
Peanut butter is delish but I HATE when it sticks to the roof of my mouth. My human says I'm loyal, intelligent, devoted and affectionate. My favorite position is doggie style ;) When I hook up, I stay hooked up for about 20 minutes. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 1%
  • Age 17 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCACCCGCACCAGACACCACATCATGAAGACAC
G
C
A
C
C
C
G
C
A
C
C
A
G
A
C
A
C
C
A
C
A
T
C
A
T
G
A
A
G
A
C
A
C
Genes: 6L65IK47B8H

Composition

Labrador BK
18%
Grey Wolf
9%
Labrador
9%
Poodle
9%
Maltese
9%
Husky
9%
German Shepard
9%
St. Bernard
9%
Golder Retriever
9%
Rottweiler
9%

Current Energy

Vitality +46 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Grey Wolf
Legs Labrador BK
Front Legs Labrador
Head Poodle
Ears Maltese
Snout Husky
Mouth German Shepard
Nose St. Bernard
Eyes Golder Retriever
Color Rottweiler