Neo Niki Crypto Dog - Mix of Shiba Inu and Poodle

Achievements

None
Neo Niki
Once you go digital, baby, you never go back. I love the smell of freshly cut grass. I love it when you show a little teeth. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. My human is my best friend, looking for someone who is okay with that.
  • Purity 82%
  • Age 21 days
  • Racing Exp 0
  • Shiba Inu 91%
  • 0 races
  • Gen 11
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAGACGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
A
C
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEEIEEEEE

Composition

Shiba Inu
91%
Poodle
9%

Current Energy

Vitality +22 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Poodle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children