Codex Cliff Bitcoin Dog - Mix of Border Collie, Labrador, Labrador BK, Poodle, Grey Wolf, Corgi and Golder Retriever

Achievements

Racer
Codex Cliff
Hi, Codex Cliff is my name. This dawg chases mice in a big data warehouse. I enjoy chasing my tail around. My turn-offs are rolled up newspapers and loud noises. I'm into leather...if I have the right partner. I love car rides when I can stick my head out the window. Looking for that special tail wag.
  • Purity 11%
  • Age 21 days
  • Racing Exp 34
  • Border Collie 27%
  • 11 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 0 3 1
 Best Time15.55 sec
No rank  Racing *** Pts
36.4 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGACCCCTACTACCCACCAGCAAGCGCAAGA
T
A
C
G
A
C
C
C
C
T
A
C
T
A
C
C
C
A
C
C
A
G
C
A
A
G
C
G
C
A
A
G
A
Genes: JILJJ556O68

Composition

Border Collie
27%
Labrador
18%
Labrador BK
18%
Poodle
9%
Grey Wolf
9%
Corgi
9%
Golder Retriever
9%

Current Energy

Vitality +58 points
Lunar Effect -12 points

Traits Breakdown

Body Border Collie
Tail Poodle
Legs Grey Wolf
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Labrador
Mouth Labrador BK
Nose Corgi
Eyes Labrador BK
Color Golder Retriever

Parents

Children

Photos

Litecoin dog race podium Bitcoin dog racing cryptocurrency pet race photo Litecoin dog race