Darby Dutches Litecoin Dog - Mix of Pitbull terrier, Corgi, Border Collie, St. Bernard, Pug and Rottweiler

Achievements

None
Darby Dutches
Here in cyberspace, I ain't got much use for a floppy disc. What's your favorite bed? Mine is the dirty laundry. I'm into group dog piles, the more the better. I love fetching anything my human throws! I don't like having to stay off the furniture. You scratch my belly and I'll scratch yours ;)
  • Purity 12%
  • Age 20 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGATACTCCTCCAGCGAATACAGCCACTCCAGC
T
G
A
T
A
C
T
C
C
T
C
C
A
G
C
G
A
A
T
A
C
A
G
C
C
A
C
T
C
C
A
G
C
Genes: BJNNO2JOHNO

Composition

Pitbull terrier
27%
Corgi
27%
Border Collie
18%
St. Bernard
9%
Pug
9%
Rottweiler
9%

Current Energy

Vitality +3 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail Border Collie
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Corgi
Ears Pug
Snout Border Collie
Mouth Corgi
Nose Rottweiler
Eyes Pitbull terrier
Color Corgi

Parents

No Children