Kimmy Keesha Cryptocurrency Dog - Mix of Corgi, German Shepard, Schnauzer, Beagle, Husky, Labrador, St. Bernard, Rottweiler and Shiba Inu

Achievements

Podium Champion
Pro Racer
Master Champion
Kimmy Keesha
Suh? How's it goin? I'm Kimmy Keesha. I was born in the web cloud. I love the smell of freshly cut grass. I hate it when my humans fool me with a pill in peanut butter! I could spend days on end chasing my tail. I get so close but it's just so fast! I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 5%
  • Age 15 months
  • Racing Exp 108
  • Corgi 18%
  • 20 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 3 7 5
 Best Time14.67 sec
No rank  Racing *** Coins
75.0 % wins (15) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: ATACTAACACCAAGCTGATCATCACACGTAAGC
A
T
A
C
T
A
A
C
A
C
C
A
A
G
C
T
G
A
T
C
A
T
C
A
C
A
C
G
T
A
A
G
C
Genes: CD45OB77HEO

Composition

Corgi
18%
German Shepard
18%
Schnauzer
9%
Beagle
9%
Husky
9%
Labrador
9%
St. Bernard
9%
Rottweiler
9%
Shiba Inu
9%

Current Energy

Vitality -23 points
Lunar Effect +6 points

Traits Breakdown

Body Schnauzer
Tail Beagle
Legs Husky
Front Legs Labrador
Head Corgi
Ears St. Bernard
Snout German Shepard
Mouth German Shepard
Nose Rottweiler
Eyes Shiba Inu
Color Corgi