Kimmy Keesha Cryptocurrency Dog - Mix of Corgi, German Shepard, Schnauzer, Beagle, Husky, Labrador, St. Bernard, Rottweiler and Shiba Inu

Achievements

Racer
Podium Champion
Kimmy Keesha
Suh? How's it goin? I'm Kimmy Keesha. I was born in the web cloud. I love the smell of freshly cut grass. I hate it when my humans fool me with a pill in peanut butter! I could spend days on end chasing my tail. I get so close but it's just so fast! I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 5%
  • Age 20 days
  • Racing Exp 36
  • Corgi 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 1 2 2
 Best Time14.92 sec
No rank  Racing *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ATACTAACACCAAGCTGATCATCACACGTAAGC
A
T
A
C
T
A
A
C
A
C
C
A
A
G
C
T
G
A
T
C
A
T
C
A
C
A
C
G
T
A
A
G
C
Genes: CD45OB77HEO

Composition

Corgi
18%
German Shepard
18%
Schnauzer
9%
Beagle
9%
Husky
9%
Labrador
9%
St. Bernard
9%
Rottweiler
9%
Shiba Inu
9%

Current Energy

Vitality +37 points
Lunar Effect +2 points

Traits Breakdown

Body Schnauzer
Tail Beagle
Legs Husky
Front Legs Labrador
Head Corgi
Ears St. Bernard
Snout German Shepard
Mouth German Shepard
Nose Rottweiler
Eyes Shiba Inu
Color Corgi