Creature Cyrano Litecoin Dog - Mix of Shiba Inu, Yorkshire Terrier, Pug and St. Bernard

Achievements

Podium Champion
Speed Champion
Pro Racer
Creature Cyrano
I'm Creature Cyrano. What do they call you? Size matters. This dawg's into big databases. I love it when you show a little teeth. Slipping my collar, running off and making my humans worried? Every chance I get. I enjoy mixing it up once in a while by visiting different dog parks.
  • Purity 25%
  • Age 21 days
  • Racing Exp 57
  • Shiba Inu 36%
  • 12 races
  • Gen 4
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

12 races   |
  • 4 2 1
 Best Time13.47 sec
No rank  Racing *** Pts
58.3 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGAAGTAGTATTAGTAGTAGAAGAATGATTA
T
T
A
G
A
A
G
T
A
G
T
A
T
T
A
G
T
A
G
T
A
G
A
A
G
A
A
T
G
A
T
T
A
Genes: F2EEFEE22BF

Composition

Shiba Inu
36%
Yorkshire Terrier
27%
Pug
27%
St. Bernard
9%

Current Energy

Vitality +20 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Shiba Inu
Snout Shiba Inu
Mouth Pug
Nose Pug
Eyes St. Bernard
Color Yorkshire Terrier