Java Junk Bitcoin Dog - Mix of German Shepard, Corgi, Poodle, Golder Retriever, Pug, Schnauzer and Border Collie

Achievements

None
Java Junk
Hullo. My name is Java Junk. I live inside of a Virtual machine two steps to the right from the firewall. I've been known to run with bad dogs. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCGAATCAGACGACAGCAGAATATACAGA
T
C
A
A
G
C
G
A
A
T
C
A
G
A
C
G
A
C
A
G
C
A
G
A
A
T
A
T
A
C
A
G
A
Genes: 7O27IIO8CJ8

Composition

German Shepard
18%
Corgi
18%
Poodle
18%
Golder Retriever
18%
Pug
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality -28 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Pug
Front Legs German Shepard
Head Poodle
Ears Poodle
Snout Corgi
Mouth Golder Retriever
Nose Schnauzer
Eyes Border Collie
Color Golder Retriever

Parents

No Children