Scooby Skippy Crypto Dog - Mix of Boxer, Maltese, St. Bernard, Shiba Inu, Golder Retriever, Pug, Labrador BK, Poodle and Rottweiler

Achievements

None
Scooby Skippy
Currently, I live on the information superhighway. I enjoy crunchy kibble and drinking from toilets. I hate never catching that damn rabbit in my dreams. Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a good Tug-O-War partner.
  • Purity 3%
  • Age 23 days
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACTGAGTAAGAAACGAAGCAGACACCCACACC
A
A
C
T
G
A
G
T
A
A
G
A
A
A
C
G
A
A
G
C
A
G
A
C
A
C
C
C
A
C
A
C
C
Genes: GBE8G26IKHK

Composition

Boxer
18%
Maltese
18%
St. Bernard
9%
Shiba Inu
9%
Golder Retriever
9%
Pug
9%
Labrador BK
9%
Poodle
9%
Rottweiler
9%

Current Energy

Vitality +18 points
Lunar Effect +2 points

Traits Breakdown

Body Boxer
Tail St. Bernard
Legs Shiba Inu
Front Legs Golder Retriever
Head Boxer
Ears Pug
Snout Labrador BK
Mouth Poodle
Nose Maltese
Eyes Rottweiler
Color Maltese