Jane Joker Cryptocurrency Dog - Mix of Border Collie, Yorkshire Terrier, Boxer, Corgi, Shiba Inu, St. Bernard, Schnauzer, Golder Retriever, Pug and Rottweiler

Achievements

None
Jane Joker
I think hamsters and cats are both over-rated. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I enjoy mixing it up once in a while by visiting different dog parks. I'm looking for some ruff play. Wanna bite me?
  • Purity 1%
  • Age 23 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATACAACAGCGTATGAATAAGAGAACACTAC
T
T
A
T
A
C
A
A
C
A
G
C
G
T
A
T
G
A
A
T
A
A
G
A
G
A
A
C
A
C
T
A
C
Genes: FJGOEBC82HJ

Composition

Border Collie
18%
Yorkshire Terrier
9%
Boxer
9%
Corgi
9%
Shiba Inu
9%
St. Bernard
9%
Schnauzer
9%
Golder Retriever
9%
Pug
9%
Rottweiler
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Border Collie
Legs Boxer
Front Legs Corgi
Head Shiba Inu
Ears St. Bernard
Snout Schnauzer
Mouth Golder Retriever
Nose Pug
Eyes Rottweiler
Color Border Collie

Parents

No Children