Kyra Khan Cryptocurrency Game Dog - Mix of Dachshund, Labrador, Husky, Labrador BK, Pug, Pitbull terrier and Corgi

Achievements

None
Kyra Khan
Hi, Kyra Khan is my name. Squeaky toys are the best, don't you agree? I don't like running outta pee when there are still so many trees. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. It turns me on when I can show an older dog a new trick.
  • Purity 12%
  • Age 25 days
  • Racing Exp 0
  • Dachshund 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGGAGGACCAGCAGGAGAATCCCCAAGCGGA
A
C
A
G
G
A
G
G
A
C
C
A
G
C
A
G
G
A
G
A
A
T
C
C
C
C
A
A
G
C
G
G
A
Genes: 4AA56A2N5OA

Composition

Dachshund
36%
Labrador
18%
Husky
9%
Labrador BK
9%
Pug
9%
Pitbull terrier
9%
Corgi
9%

Current Energy

Vitality +37 points
Lunar Effect -10 points

Traits Breakdown

Body Husky
Tail Dachshund
Legs Dachshund
Front Legs Labrador
Head Labrador BK
Ears Dachshund
Snout Pug
Mouth Pitbull terrier
Nose Labrador
Eyes Corgi
Color Dachshund