Nick Nosey Bitcoin Dog - Mix of Husky, Beagle, Border Collie, Boxer, Pitbull terrier and Yorkshire Terrier

Achievements

None
Nick Nosey
Even living on the internet like I do, too much kibble makes my bandwidth expand. I'm the best at running circle 8's. I don't mind sharing my bed with someone I just met, if we can cuddle. I hate never catching that damn rabbit in my dreams. As a designer, I suggest low windows or couch backs next to windows without curtains.
  • Purity 11%
  • Age 25 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAACAACATACTCCTTACTAAACTACAACACA
C
T
A
A
C
A
A
C
A
T
A
C
T
C
C
T
T
A
C
T
A
A
A
C
T
A
C
A
A
C
A
C
A
Genes: D44JNFDGJG4

Composition

Husky
27%
Beagle
18%
Border Collie
18%
Boxer
18%
Pitbull terrier
9%
Yorkshire Terrier
9%

Current Energy

Vitality +27 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Husky
Legs Husky
Front Legs Border Collie
Head Pitbull terrier
Ears Yorkshire Terrier
Snout Beagle
Mouth Boxer
Nose Border Collie
Eyes Boxer
Color Husky

Parents

No Children