Navi Nathan Digital Cryptocurrency Dog - Mix of Corgi, Husky, Boxer, Shiba Inu, Border Collie, Pug and Yorkshire Terrier

Achievements

None
Navi Nathan
Hey, Baby. I'm Navi Nathan. I'm into chasing fast cars, squirrels and my tail. I've always had a crush on Lassie. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 11%
  • Age 23 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCAGCGTATACACAACAGAAAACAGCAACTTA
A
G
C
A
G
C
G
T
A
T
A
C
A
C
A
A
C
A
G
A
A
A
A
C
A
G
C
A
A
C
T
T
A
Genes: OOEJ442GOGF

Composition

Corgi
27%
Husky
18%
Boxer
18%
Shiba Inu
9%
Border Collie
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality +32 points
Lunar Effect -8 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Shiba Inu
Front Legs Border Collie
Head Husky
Ears Husky
Snout Pug
Mouth Boxer
Nose Corgi
Eyes Boxer
Color Yorkshire Terrier