Julian Jelly-Bean Crypto Game Dog - Mix of Pug, Rottweiler, French Bulldog, Golder Retriever, Labrador, Husky and St. Bernard

Achievements

Racer
Julian Jelly-Bean
Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. As a perfectionist, I have to find just the right 'spot'. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! Looking for that special tail wag.
  • Purity 20%
  • Age 24 days
  • Racing Exp 4
  • Pug 45%
  • 4 races
  • Gen 5
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 0 0
 Best Time15.33 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACGAAGAACGAAGACCAGAAGAAGAAACATGA
C
A
C
G
A
A
G
A
A
C
G
A
A
G
A
C
C
A
G
A
A
G
A
A
G
A
A
A
C
A
T
G
A
Genes: H229852224B

Composition

Pug
45%
Rottweiler
9%
French Bulldog
9%
Golder Retriever
9%
Labrador
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality +4 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs French Bulldog
Head Golder Retriever
Ears Labrador
Snout Pug
Mouth Pug
Nose Pug
Eyes Husky
Color St. Bernard

Parents

No Children

Photos