Julian Jelly-Bean Crypto Game Dog - Mix of Pug, Rottweiler, French Bulldog, Golder Retriever, Labrador, Husky and St. Bernard

Achievements

Racer
Julian Jelly-Bean
Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. As a perfectionist, I have to find just the right 'spot'. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! Looking for that special tail wag.
  • Purity 20%
  • Age 15 months
  • Racing Exp 22
  • Pug 45%
  • 10 races
  • Gen 5
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 1 0 1
 Best Time15.33 sec
No rank  Racing *** Coins
20.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGAAGAACGAAGACCAGAAGAAGAAACATGA
C
A
C
G
A
A
G
A
A
C
G
A
A
G
A
C
C
A
G
A
A
G
A
A
G
A
A
A
C
A
T
G
A
Genes: H229852224B

Composition

Pug
45%
Rottweiler
9%
French Bulldog
9%
Golder Retriever
9%
Labrador
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -56 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs French Bulldog
Head Golder Retriever
Ears Labrador
Snout Pug
Mouth Pug
Nose Pug
Eyes Husky
Color St. Bernard

Parents

No Children

Photos

Bitcoin canine racing photo Litecoin pet race podium