Marcy Marcellini Litecoin Dog - Mix of Boxer, Border Collie, French Bulldog, Grey Wolf, Beagle, Rottweiler, Corgi, Labrador BK and Schnauzer

Achievements

Racer
Marcy Marcellini
How do you do? I'm Marcy Marcellini. I'm having some new data architecture built for me, then I'd like to have you over to my place. I'm going kill that damn Nyan Cat if I can catch it. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 4%
  • Age 39 months
  • Racing Exp 20
  • Boxer 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 2 1
 Best Time15.72 sec
No rank  Racing *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACCGACCCCTAAACCACAGCAACGCAAACATA
T
A
C
C
G
A
C
C
C
C
T
A
A
A
C
C
A
C
A
G
C
A
A
C
G
C
A
A
A
C
A
T
A
Genes: J9LDGHOG6GC

Composition

Boxer
27%
Border Collie
9%
French Bulldog
9%
Grey Wolf
9%
Beagle
9%
Rottweiler
9%
Corgi
9%
Labrador BK
9%
Schnauzer
9%

Current Energy

Vitality -26 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail French Bulldog
Legs Grey Wolf
Front Legs Beagle
Head Boxer
Ears Rottweiler
Snout Corgi
Mouth Boxer
Nose Labrador BK
Eyes Boxer
Color Schnauzer

Parents

No Children

Photos

Litecoin doggy race crypto dog racing virtual canine race photo Litecoin dog racing cryptocurrency dog racing Litecoin dog racing podium Bitcoin dog race online dog race results