Danger Denali Litecoin Dog - Mix of Schnauzer, Yorkshire Terrier, Grey Wolf, Border Collie, Pug, Poodle, Maltese, Rottweiler and Labrador BK

Achievements

Racer
Podium Champion
Danger Denali
My female human wears crotchless undies, but she doesn't like the ones I make for her! I don't understand why my human tries to give me tap water. I expect filtered and distilled! I enjoy chasing my tail around. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos.
  • Purity 5%
  • Age 29 days
  • Racing Exp 39
  • Schnauzer 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 2 2 1
 Best Time15.07 sec
Rank 99  Racing *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATAATACCCTTATACGAATTAGACACCCACGCA
A
T
A
A
T
A
C
C
C
T
T
A
T
A
C
G
A
A
T
T
A
G
A
C
A
C
C
C
A
C
G
C
A
Genes: CCLFJ2FIKH6

Composition

Schnauzer
18%
Yorkshire Terrier
18%
Grey Wolf
9%
Border Collie
9%
Pug
9%
Poodle
9%
Maltese
9%
Rottweiler
9%
Labrador BK
9%

Current Energy

Vitality +38 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Grey Wolf
Front Legs Yorkshire Terrier
Head Border Collie
Ears Pug
Snout Yorkshire Terrier
Mouth Poodle
Nose Maltese
Eyes Rottweiler
Color Labrador BK