Dead Red Dee Bitcoin Dog - Mix of Dachshund, Pitbull terrier, Schnauzer, Grey Wolf, Pug, Golder Retriever, Labrador and Corgi

Achievements

Racer
Dead Red Dee
A-yo...Call me Dead Red Dee. Trust me. Leashes, collar and whips can be fun if you know what you're doing. As a designer, I suggest low windows or couch backs next to windows without curtains. I enjoy finding and eating frozen cat turds in the winter. Bon appétit!
  • Purity 6%
  • Age 31 days
  • Racing Exp 20
  • Dachshund 27%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 1 0 1
 Best Time14.93 sec
No rank  Racing *** Pts
25.0 % wins (2) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ATAGGATCCCCCGAAGGAAGATCCCCAAGCGGA
A
T
A
G
G
A
T
C
C
C
C
C
G
A
A
G
G
A
A
G
A
T
C
C
C
C
A
A
G
C
G
G
A
Genes: CANL2A8N5OA

Composition

Dachshund
27%
Pitbull terrier
18%
Schnauzer
9%
Grey Wolf
9%
Pug
9%
Golder Retriever
9%
Labrador
9%
Corgi
9%

Current Energy

Vitality +19 points
Lunar Effect -12 points

Traits Breakdown

Body Schnauzer
Tail Dachshund
Legs Pitbull terrier
Front Legs Grey Wolf
Head Pug
Ears Dachshund
Snout Golder Retriever
Mouth Pitbull terrier
Nose Labrador
Eyes Corgi
Color Dachshund

Parents

Children

Photos

cryptocurrency canine racing podium virtual dog racing