Geppetto Guinevere Virtual Crypto Game Dog - Mix of Yorkshire Terrier, Labrador, Pitbull terrier, Pug, Dachshund, Boxer and German Shepard

Achievements

Racer
Podium Champion
Geppetto Guinevere
Pleased to meet you! My name's Geppetto Guinevere. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. Creativity is my middle name... I turn everything in to a chew toy. I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 8%
  • Age 15 months
  • Racing Exp 58
  • Yorkshire Terrier 18%
  • 9 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 3 3 2
 Best Time14.63 sec
No rank  Racing *** Coins
88.9 % wins (8) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACCATCCGGATTAGAAGAAAACTCACCATCC
T
T
A
C
C
A
T
C
C
G
G
A
T
T
A
G
A
A
G
A
A
A
A
C
T
C
A
C
C
A
T
C
C
Genes: F5NAF22G75N

Composition

Yorkshire Terrier
18%
Labrador
18%
Pitbull terrier
18%
Pug
18%
Dachshund
9%
Boxer
9%
German Shepard
9%

Current Energy

Vitality -50 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Labrador
Legs Pitbull terrier
Front Legs Dachshund
Head Yorkshire Terrier
Ears Pug
Snout Pug
Mouth Boxer
Nose German Shepard
Eyes Labrador
Color Pitbull terrier