Amos Austin Digital Cryptocurrency Game Dog - Mix of St. Bernard, German Shepard, Yorkshire Terrier, Beagle, Shiba Inu, Schnauzer, Golder Retriever, Labrador BK and Border Collie

Achievements

Racer
Amos Austin
My name is Amos Austin and I'd really like to sniff you. I'm a super-dog in the internet universe. As a designer, I suggest low windows or couch backs next to windows without curtains. I enjoy chasing my tail around. I've always wanted to be in commercials and be treated as the star I am!
  • Purity 3%
  • Age 4 months
  • Racing Exp 48
  • St. Bernard 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 5 0 1
8 races    Best Time14.27 sec
No rank  Racing *** Coins
75.0 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATGATCACTAGTATGAATAAGATCAGCATAC
T
T
A
T
G
A
T
C
A
C
T
A
G
T
A
T
G
A
A
T
A
A
G
A
T
C
A
G
C
A
T
A
C
Genes: FB7DEBC876J

Composition

St. Bernard
18%
German Shepard
18%
Yorkshire Terrier
9%
Beagle
9%
Shiba Inu
9%
Schnauzer
9%
Golder Retriever
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality -30 points
Lunar Effect +6 points

Traits Breakdown

Body Yorkshire Terrier
Tail St. Bernard
Legs German Shepard
Front Legs Beagle
Head Shiba Inu
Ears St. Bernard
Snout Schnauzer
Mouth Golder Retriever
Nose German Shepard
Eyes Labrador BK
Color Border Collie