Logan Linux Litecoin Game Dog - Mix of Grey Wolf, Border Collie, Poodle, Dachshund, Beagle, Pug, Shiba Inu, German Shepard, Boxer and Corgi

Achievements

Racer
Podium Champion
Logan Linux
Hola! My name is Logan Linux. Baby, I'm made from the same stuff as dreams. I like giving wet kisses. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! Removing excess stuffing from pillows is my favorite hobby.
  • Purity 1%
  • Age 31 days
  • Racing Exp 29
  • Grey Wolf 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 1 2
 Best Time15.10 sec
No rank  Racing *** Pts
66.7 % wins (4) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TACGACGGACTACCCGAAGTATCAAACCCCAGC
T
A
C
G
A
C
G
G
A
C
T
A
C
C
C
G
A
A
G
T
A
T
C
A
A
A
C
C
C
C
A
G
C
Genes: JIADL2E7GLO

Composition

Grey Wolf
18%
Border Collie
9%
Poodle
9%
Dachshund
9%
Beagle
9%
Pug
9%
Shiba Inu
9%
German Shepard
9%
Boxer
9%
Corgi
9%

Current Energy

Vitality +5 points
Lunar Effect -14 points

Traits Breakdown

Body Border Collie
Tail Poodle
Legs Dachshund
Front Legs Beagle
Head Grey Wolf
Ears Pug
Snout Shiba Inu
Mouth German Shepard
Nose Boxer
Eyes Grey Wolf
Color Corgi