Eleanor Ewok Digital Cryptocurrency Game Dog - Mix of Beagle, Shiba Inu, Labrador BK, Yorkshire Terrier, Labrador, St. Bernard, German Shepard, Poodle, Husky and Pitbull terrier

Achievements

Racer
Eleanor Ewok
The Ethernet where I live, rocks. I believe running along the beach to catch a stick can be nearly orgasmic. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!
  • Purity 1%
  • Age 31 days
  • Racing Exp 18
  • Beagle 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 1
 Best Time15.53 sec
Rank 58  Racing *** Pts
33.3 % wins (2) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GTACTAGCACTATTACCATGATCAGACACATCC
G
T
A
C
T
A
G
C
A
C
T
A
T
T
A
C
C
A
T
G
A
T
C
A
G
A
C
A
C
A
T
C
C
Genes: ED6DF5B7I4N

Composition

Beagle
18%
Shiba Inu
9%
Labrador BK
9%
Yorkshire Terrier
9%
Labrador
9%
St. Bernard
9%
German Shepard
9%
Poodle
9%
Husky
9%
Pitbull terrier
9%

Current Energy

Vitality +16 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs Labrador BK
Front Legs Beagle
Head Yorkshire Terrier
Ears Labrador
Snout St. Bernard
Mouth German Shepard
Nose Poodle
Eyes Husky
Color Pitbull terrier