Benny Beauty Bitcoin Dog - Mix of Corgi, Grey Wolf, Golder Retriever, Poodle, Labrador BK, Boxer, German Shepard, St. Bernard and Schnauzer

Achievements

Racer
Benny Beauty
Benny Beauty is the name, love is my game. And fetch of course... In the big data server, I sorta rule. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! Getting out of a long relationship, not looking for another
  • Purity 3%
  • Age 29 days
  • Racing Exp 2
  • Corgi 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time16.10 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: AGCCCCAGAGACGCACCCAACTCAAGCTGAATA
A
G
C
C
C
C
A
G
A
G
A
C
G
C
A
C
C
C
A
A
C
T
C
A
A
G
C
T
G
A
A
T
A
Genes: OL8I6LG7OBC

Composition

Corgi
18%
Grey Wolf
18%
Golder Retriever
9%
Poodle
9%
Labrador BK
9%
Boxer
9%
German Shepard
9%
St. Bernard
9%
Schnauzer
9%

Current Energy

Vitality +17 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Grey Wolf
Legs Golder Retriever
Front Legs Poodle
Head Labrador BK
Ears Grey Wolf
Snout Boxer
Mouth German Shepard
Nose Corgi
Eyes St. Bernard
Color Schnauzer

Parents

No Children

Photos