Gulliver Griffen Digital Cryptocurrency Dog - Mix of Golder Retriever, Corgi, Husky, German Shepard, Schnauzer, Beagle and St. Bernard

Achievements

Racer
Gulliver Griffen
Yo! I'm Gulliver Griffen and I'd like to rock your world. Blue toilet water turns me off. Little Bow Wow is my favorite musician. I just assume he's a dog... I like to respond to sad puppy eyes with sad puppy eyes of my own. I slept with a cat and I liked it.
  • Purity 8%
  • Age 31 days
  • Racing Exp 23
  • Golder Retriever 18%
  • 4 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 2 0 1
 Best Time15.58 sec
No rank  Racing *** Pts
75.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAAGCAGCACAAGAACAATATCACTATCATGA
A
G
A
A
G
C
A
G
C
A
C
A
A
G
A
A
C
A
A
T
A
T
C
A
C
T
A
T
C
A
T
G
A
Genes: 8OO484C7D7B

Composition

Golder Retriever
18%
Corgi
18%
Husky
18%
German Shepard
18%
Schnauzer
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality +11 points
Lunar Effect +2 points

Traits Breakdown

Body Golder Retriever
Tail Corgi
Legs Corgi
Front Legs Husky
Head Golder Retriever
Ears Husky
Snout Schnauzer
Mouth German Shepard
Nose Beagle
Eyes German Shepard
Color St. Bernard

Parents

No Children

Photos

Litecoin doggy race results Bitcoin doggy racing virtual dog racing photo