Dana Danger Crypto Game Dog - Mix of Corgi, Pitbull terrier, Rottweiler, Maltese, Shiba Inu, St. Bernard, Grey Wolf, Labrador and Labrador BK

Achievements

None
Dana Danger
Who's a good dog? Hopefully you! Dana Danger here. Spiked dog collars really turn me on. I enjoy staying active, and running circles around puppies and young children. Power outages and computer viruses scare me! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACACCAGCTCCGTATGACCCCCAGCAAGCTCC
C
A
C
A
C
C
A
G
C
T
C
C
G
T
A
T
G
A
C
C
C
C
C
A
G
C
A
A
G
C
T
C
C
Genes: HKONEBL56ON

Composition

Corgi
18%
Pitbull terrier
18%
Rottweiler
9%
Maltese
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality +27 points
Lunar Effect +12 points

Traits Breakdown

Body Rottweiler
Tail Maltese
Legs Corgi
Front Legs Pitbull terrier
Head Shiba Inu
Ears St. Bernard
Snout Grey Wolf
Mouth Labrador
Nose Labrador BK
Eyes Corgi
Color Pitbull terrier

Parents

No Children