Speed Bump Siri Litecoin Dog - Mix of Poodle, Pitbull terrier, Husky, Labrador, Shiba Inu, Corgi, Boxer, German Shepard and Maltese

Achievements

None
Speed Bump Siri
How goes it? I'm Speed Bump Siri. As a digital dog, let me say Bob Dole did not invent the internet. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I'm into leather...if I have the right partner.
  • Purity 5%
  • Age 29 days
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGACGACCCATCCGTAAGCTCCAACTCAACC
A
C
A
G
A
C
G
A
C
C
C
A
T
C
C
G
T
A
A
G
C
T
C
C
A
A
C
T
C
A
A
C
C
Genes: 4II5NEONG7K

Composition

Poodle
18%
Pitbull terrier
18%
Husky
9%
Labrador
9%
Shiba Inu
9%
Corgi
9%
Boxer
9%
German Shepard
9%
Maltese
9%

Current Energy

Vitality +32 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Poodle
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout Corgi
Mouth Pitbull terrier
Nose Boxer
Eyes German Shepard
Color Maltese