Trixie Thelma Cryptocurrency Dog - Mix of German Shepard, Golder Retriever, Boxer, Corgi, Grey Wolf, Dachshund and Labrador BK

Achievements

None
Trixie Thelma
I am a guard dog for the data warehouse. I don't like having to stay in the car when my people go inside. I like to play fetch with a tennis ball. I'm always up for some puppy action, is that wrong? If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 14%
  • Age 29 days
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAACTCAAGCCCCGGATCATCAGCAAGAAGA
T
C
A
A
A
C
T
C
A
A
G
C
C
C
C
G
G
A
T
C
A
T
C
A
G
C
A
A
G
A
A
G
A
Genes: 7G7OLA77688

Composition

German Shepard
36%
Golder Retriever
18%
Boxer
9%
Corgi
9%
Grey Wolf
9%
Dachshund
9%
Labrador BK
9%

Current Energy

Vitality +45 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs German Shepard
Front Legs Corgi
Head Grey Wolf
Ears Dachshund
Snout German Shepard
Mouth German Shepard
Nose Labrador BK
Eyes Golder Retriever
Color Golder Retriever