Abra Austin Bitcoin Dog - Mix of Husky, Shiba Inu, Pitbull terrier, Corgi, St. Bernard, Labrador BK and French Bulldog

Achievements

None
Abra Austin
Hey, Baby. I'm Abra Austin. Have you ever dated a digital creation before? Blue toilet water turns me off. It doesn't matter to me which team I play for... I just like tail. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 12%
  • Age 31 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCACAAGCACATGAGTAACAACAGCAGTACGA
T
C
C
A
C
A
A
G
C
A
C
A
T
G
A
G
T
A
A
C
A
A
C
A
G
C
A
G
T
A
C
G
A
Genes: N4O4BE446E9

Composition

Husky
36%
Shiba Inu
18%
Pitbull terrier
9%
Corgi
9%
St. Bernard
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality +34 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Husky
Legs Corgi
Front Legs Husky
Head St. Bernard
Ears Shiba Inu
Snout Husky
Mouth Husky
Nose Labrador BK
Eyes Shiba Inu
Color French Bulldog