Apache Agent 47 Crypto Game Dog - Mix of Husky, Dachshund, French Bulldog, Maltese, Border Collie, Golder Retriever, Labrador BK, Corgi, Yorkshire Terrier and Pitbull terrier

Achievements

None
Apache Agent 47
Here in cyberspace, I ain't got much use for a floppy disc. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGACGAACCTACACAACAAGAGCAAGCTTATCC
G
G
A
C
G
A
A
C
C
T
A
C
A
C
A
A
C
A
A
G
A
G
C
A
A
G
C
T
T
A
T
C
C
Genes: A9KJ4486OFN

Composition

Husky
18%
Dachshund
9%
French Bulldog
9%
Maltese
9%
Border Collie
9%
Golder Retriever
9%
Labrador BK
9%
Corgi
9%
Yorkshire Terrier
9%
Pitbull terrier
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail French Bulldog
Legs Maltese
Front Legs Border Collie
Head Husky
Ears Husky
Snout Golder Retriever
Mouth Labrador BK
Nose Corgi
Eyes Yorkshire Terrier
Color Pitbull terrier