Killer Kewpie Litecoin Game Dog - Mix of Golder Retriever, Schnauzer, Husky, German Shepard, Corgi, Pug, Rottweiler, St. Bernard and Boxer

Achievements

None
Killer Kewpie
It's a barkin' beautiful day! Killer Kewpie here. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAAGATCAATAATAAGAAGCGAACACTGAAAC
A
C
A
A
G
A
T
C
A
A
T
A
A
T
A
A
G
A
A
G
C
G
A
A
C
A
C
T
G
A
A
A
C
Genes: 487CC8O2HBG

Composition

Golder Retriever
18%
Schnauzer
18%
Husky
9%
German Shepard
9%
Corgi
9%
Pug
9%
Rottweiler
9%
St. Bernard
9%
Boxer
9%

Current Energy

Vitality +32 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs German Shepard
Front Legs Schnauzer
Head Schnauzer
Ears Golder Retriever
Snout Corgi
Mouth Pug
Nose Rottweiler
Eyes St. Bernard
Color Boxer

Parents

No Children