Felix Farley Digital Cryptocurrency Game Dog - Mix of Maltese, Border Collie, Labrador, French Bulldog, Corgi, Pug, Yorkshire Terrier and Rottweiler

Achievements

None
Felix Farley
Let me introduce myself, I'm Felix Farley. I run exclusively on code. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 4%
  • Age 29 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTACCGATACAGCACCGAATTACCACACCCA
A
C
C
T
A
C
C
G
A
T
A
C
A
G
C
A
C
C
G
A
A
T
T
A
C
C
A
C
A
C
C
C
A
Genes: KJ9JOK2F5H5

Composition

Maltese
18%
Border Collie
18%
Labrador
18%
French Bulldog
9%
Corgi
9%
Pug
9%
Yorkshire Terrier
9%
Rottweiler
9%

Current Energy

Vitality +15 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Border Collie
Legs French Bulldog
Front Legs Border Collie
Head Corgi
Ears Maltese
Snout Pug
Mouth Yorkshire Terrier
Nose Labrador
Eyes Rottweiler
Color Labrador

Parents

No Children