Robin Hood Rosebud Crypto Game Dog - Mix of Shiba Inu, Boxer, Grey Wolf, Schnauzer, Beagle, German Shepard, Labrador, Border Collie, St. Bernard and Maltese

Achievements

None
Robin Hood Rosebud
I'm not a bad dog, my data is just configured that way. I like never worrying about my dog poo. I've got people for that. The place I like most in the world is curled up in my human's bed, hogging all the covers! I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I 'm here for something RUFF ;)
  • Purity 1%
  • Age 29 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACCCCATACTATCACCATACGTATGAACCGTA
A
A
C
C
C
C
A
T
A
C
T
A
T
C
A
C
C
A
T
A
C
G
T
A
T
G
A
A
C
C
G
T
A
Genes: GLCD75JEBKE

Composition

Shiba Inu
18%
Boxer
9%
Grey Wolf
9%
Schnauzer
9%
Beagle
9%
German Shepard
9%
Labrador
9%
Border Collie
9%
St. Bernard
9%
Maltese
9%

Current Energy

Vitality +12 points
Lunar Effect +10 points

Traits Breakdown

Body Boxer
Tail Grey Wolf
Legs Schnauzer
Front Legs Beagle
Head German Shepard
Ears Labrador
Snout Border Collie
Mouth Shiba Inu
Nose St. Bernard
Eyes Maltese
Color Shiba Inu

Parents

No Children