Jags Jetta Litecoin Game Dog - Mix of German Shepard, Grey Wolf, Shiba Inu, Border Collie, Corgi, Husky, Golder Retriever, Boxer and Poodle

Achievements

None
Jags Jetta
I don't mind sharing my bed with someone I just met, if we can cuddle. My favorite place to sleep is under the covers between my humans. I hate it when my humans fart and they blame me! I am on a mission to sniff all the butts in the world. ALL the butts. I want a mate that knows how to give a proper belly rub!
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATACTCAAGCACAAGAAACTCACCCCCCGAC
G
T
A
T
A
C
T
C
A
A
G
C
A
C
A
A
G
A
A
A
C
T
C
A
C
C
C
C
C
C
G
A
C
Genes: EJ7O48G7LLI

Composition

German Shepard
18%
Grey Wolf
18%
Shiba Inu
9%
Border Collie
9%
Corgi
9%
Husky
9%
Golder Retriever
9%
Boxer
9%
Poodle
9%

Current Energy

Vitality +30 points
Lunar Effect -14 points

Traits Breakdown

Body Shiba Inu
Tail Border Collie
Legs German Shepard
Front Legs Corgi
Head Husky
Ears Golder Retriever
Snout Boxer
Mouth German Shepard
Nose Grey Wolf
Eyes Grey Wolf
Color Poodle

Parents

No Children