Blanka Bridgette Litecoin Dog - Mix of Boxer, Rottweiler, Beagle, Labrador BK, Pug, Yorkshire Terrier, German Shepard and Maltese

Achievements

None
Blanka Bridgette
Whatcha know, honey. Blanka Bridgette here. My favorite place to sleep is under the covers between my humans. I really enjoy heavy petting. My turn-offs are rolled up newspapers and loud noises. Getting out of a long relationship, not looking for another
  • Purity 8%
  • Age 31 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACCTAGCACACGAAAACAACTTATCACACACC
A
A
C
C
T
A
G
C
A
C
A
C
G
A
A
A
A
C
A
A
C
T
T
A
T
C
A
C
A
C
A
C
C
Genes: GD6H2GGF7HK

Composition

Boxer
27%
Rottweiler
18%
Beagle
9%
Labrador BK
9%
Pug
9%
Yorkshire Terrier
9%
German Shepard
9%
Maltese
9%

Current Energy

Vitality +26 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Beagle
Legs Labrador BK
Front Legs Rottweiler
Head Pug
Ears Boxer
Snout Boxer
Mouth Yorkshire Terrier
Nose German Shepard
Eyes Rottweiler
Color Maltese

Parents

No Children