Squirt Scooby-Doo Crypto Dog - Mix of Schnauzer, Labrador, St. Bernard, Rottweiler, Labrador BK, Poodle, Golder Retriever, French Bulldog, Grey Wolf and Husky

Achievements

None
Squirt Scooby-Doo
What's up? I'm Squirt Scooby-Doo. I really dislike stinky flea collars. I may need de-worming. I like to work out by digging fresh holes in landscaped yards. My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Schnauzer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATGACACGCAGACAGACGACCCATAACAATA
C
C
A
T
G
A
C
A
C
G
C
A
G
A
C
A
G
A
C
G
A
C
C
C
A
T
A
A
C
A
A
T
A
Genes: 5BH6I89LC4C

Composition

Schnauzer
18%
Labrador
9%
St. Bernard
9%
Rottweiler
9%
Labrador BK
9%
Poodle
9%
Golder Retriever
9%
French Bulldog
9%
Grey Wolf
9%
Husky
9%

Current Energy

Vitality +43 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador
Tail St. Bernard
Legs Rottweiler
Front Legs Labrador BK
Head Poodle
Ears Golder Retriever
Snout French Bulldog
Mouth Grey Wolf
Nose Schnauzer
Eyes Husky
Color Schnauzer

Parents

No Children