Sonny Sydney Digital Cryptocurrency Dog - Mix of Corgi, Grey Wolf, Labrador and Labrador BK
Sonny Sydney
  • Purity 39%
  • Age 72 months
  • Racing Exp 2
  • Corgi 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Rolling around on the carpet after a bath is my favorite way to dry. I'm into recreational spankings and a little 'ruff' play. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I love it when you show a little teeth.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time17.17 sec
No rank  RacingĀ *** Pts
0.0% wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCCCCAGCAGCAGCAGCAGCAGCCCAGCACCC
C
C
C
C
C
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
C
C
A
G
C
A
C
C
C
Genes: LLOOOOOO56L

Composition

Corgi
55%
Grey Wolf
27%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -35 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Corgi
Snout Corgi
Mouth Corgi
Nose Labrador
Eyes Labrador BK
Color Grey Wolf

Parents

No Children

Photos

Bitcoin doggy racing Bitcoin pet racing podium cryptocurrency pet racing results virtual pet racing photo Litecoin pet race cryptocurrency dog race photo cryptocurrency dog racing podium online dog race photo
Gift