Sonny Sydney Digital Cryptocurrency Dog - Mix of Corgi, Grey Wolf, Labrador and Labrador BK

Achievements

None
Sonny Sydney
Rolling around on the carpet after a bath is my favorite way to dry. I'm into recreational spankings and a little 'ruff' play. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I love it when you show a little teeth.
  • Purity 39%
  • Age 43 months
  • Racing Exp 0
  • Corgi 55%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCAGCAGCAGCAGCAGCAGCCCAGCACCC
C
C
C
C
C
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
C
C
A
G
C
A
C
C
C
Genes: LLOOOOOO56L

Composition

Corgi
55%
Grey Wolf
27%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -35 points
Lunar Effect +6 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Corgi
Snout Corgi
Mouth Corgi
Nose Labrador
Eyes Labrador BK
Color Grey Wolf