Argus Atlas Virtual Crypto Dog - Mix of Pug, Maltese, Beagle, St. Bernard, Husky, Corgi, Labrador BK and German Shepard

Achievements

Racer
Argus Atlas
Hello, I'm Argus Atlas. How's it goin'? I run exclusively on code. The place I like most in the world is curled up in my human's bed, hogging all the covers! I really enjoy heavy petting. I hate not being allowed to hunt treasure in the garbage. It smells so good!
  • Purity 4%
  • Age 31 days
  • Racing Exp 7
  • Pug 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time15.42 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGAGAAACCCTAACCACAAGCGCATCACTAGAA
T
G
A
G
A
A
A
C
C
C
T
A
A
C
C
A
C
A
A
G
C
G
C
A
T
C
A
C
T
A
G
A
A
Genes: B2KDK4O67D2

Composition

Pug
18%
Maltese
18%
Beagle
18%
St. Bernard
9%
Husky
9%
Corgi
9%
Labrador BK
9%
German Shepard
9%

Current Energy

Vitality -21 points
Lunar Effect +10 points

Traits Breakdown

Body St. Bernard
Tail Pug
Legs Maltese
Front Legs Beagle
Head Maltese
Ears Husky
Snout Corgi
Mouth Labrador BK
Nose German Shepard
Eyes Beagle
Color Pug

Parents

No Children

Photos

virtual doggy racing