Loki Luke Skywalker Crypto Game Dog - Mix of Schnauzer, Pug, Husky, Yorkshire Terrier, Grey Wolf, Maltese, Shiba Inu, Poodle and Pitbull terrier

Achievements

Racer
Loki Luke Skywalker
Hi! My name is Loki Luke Skywalker. I'll outrun you for the ball if I can...that's just how I roll. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I want someone who can show me a good time; I'll do the same for you.
  • Purity 6%
  • Age 31 days
  • Racing Exp 8
  • Schnauzer 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time15.30 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAACATTACCCACCGTAGACATATCCATAATA
G
A
A
A
C
A
T
T
A
C
C
C
A
C
C
G
T
A
G
A
C
A
T
A
T
C
C
A
T
A
A
T
A
Genes: 24FLKEICNCC

Composition

Schnauzer
27%
Pug
9%
Husky
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Maltese
9%
Shiba Inu
9%
Poodle
9%
Pitbull terrier
9%

Current Energy

Vitality +14 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Husky
Legs Yorkshire Terrier
Front Legs Grey Wolf
Head Maltese
Ears Shiba Inu
Snout Poodle
Mouth Schnauzer
Nose Pitbull terrier
Eyes Schnauzer
Color Schnauzer

Parents

No Children

Photos

cryptocurrency pet racing results