Travis Teddybear Bitcoin Game Dog - Mix of Pitbull terrier, St. Bernard, Labrador, Boxer, Beagle, Grey Wolf, Pug, Schnauzer and Labrador BK

Achievements

Racer
Travis Teddybear
Top o' the mornin' to ya! I'm Travis Teddybear. I'm willing to try little bondage, so my human chained me up! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I need someone that "brings home the bacon"!
  • Purity 3%
  • Age 31 days
  • Racing Exp 1
  • Pitbull terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.33 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATCCAACTCCCTATGACCCGAAATAGCATGA
C
C
A
T
C
C
A
A
C
T
C
C
C
T
A
T
G
A
C
C
C
G
A
A
A
T
A
G
C
A
T
G
A
Genes: 5NGNDBL2C6B

Composition

Pitbull terrier
18%
St. Bernard
18%
Labrador
9%
Boxer
9%
Beagle
9%
Grey Wolf
9%
Pug
9%
Schnauzer
9%
Labrador BK
9%

Current Energy

Vitality +26 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador
Tail Pitbull terrier
Legs Boxer
Front Legs Pitbull terrier
Head Beagle
Ears St. Bernard
Snout Grey Wolf
Mouth Pug
Nose Schnauzer
Eyes Labrador BK
Color St. Bernard

Parents

No Children

Photos