Dobie Duke Crypto Dog - Mix of Pug, St. Bernard, Boxer, Beagle, Border Collie, Yorkshire Terrier, Rottweiler, Grey Wolf and Pitbull terrier

Achievements

Racer
Dobie Duke
Dobie Duke here, let's shake. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. Being able to lick myself is nice, but I want to find my special someone.
  • Purity 5%
  • Age 31 days
  • Racing Exp 8
  • Pug 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time15.23 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAATGAAACCTATACTGATTACACCCCTCCGAA
G
A
A
T
G
A
A
A
C
C
T
A
T
A
C
T
G
A
T
T
A
C
A
C
C
C
C
T
C
C
G
A
A
Genes: 2BGDJBFHLN2

Composition

Pug
18%
St. Bernard
18%
Boxer
9%
Beagle
9%
Border Collie
9%
Yorkshire Terrier
9%
Rottweiler
9%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality +9 points
Lunar Effect +2 points

Traits Breakdown

Body Pug
Tail St. Bernard
Legs Boxer
Front Legs Beagle
Head Border Collie
Ears St. Bernard
Snout Yorkshire Terrier
Mouth Rottweiler
Nose Grey Wolf
Eyes Pitbull terrier
Color Pug

Parents

No Children

Photos

Bitcoin dog racing