Bond Boomerang Bitcoin Dog - Mix of Rottweiler, Shiba Inu, German Shepard, Labrador BK, St. Bernard, Maltese, Dachshund, Beagle and Grey Wolf

Achievements

Racer
Bond Boomerang
A-yo...Call me Bond Boomerang. The smell of fresh manure to roll in makes me wild. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! I'll be honest...Napping is my favorite so we gotta go slow.
  • Purity 3%
  • Age 31 days
  • Racing Exp 8
  • Rottweiler 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time15.43 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTCAGCATGAACCCACGGAGTACTACCCGTA
C
A
C
T
C
A
G
C
A
T
G
A
A
C
C
C
A
C
G
G
A
G
T
A
C
T
A
C
C
C
G
T
A
Genes: H76BKHAEDLE

Composition

Rottweiler
18%
Shiba Inu
18%
German Shepard
9%
Labrador BK
9%
St. Bernard
9%
Maltese
9%
Dachshund
9%
Beagle
9%
Grey Wolf
9%

Current Energy

Vitality +26 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail German Shepard
Legs Labrador BK
Front Legs St. Bernard
Head Maltese
Ears Rottweiler
Snout Dachshund
Mouth Shiba Inu
Nose Beagle
Eyes Grey Wolf
Color Shiba Inu

Parents

No Children

Photos

Litecoin pet racing