Karma Kosmo Crypto Dog - Mix of Pitbull terrier, St. Bernard, Pug, German Shepard, Labrador BK, Dachshund, Maltese, Poodle and Grey Wolf

Achievements

Racer
Karma Kosmo
Howdy! I'm Karma Kosmo. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'll outrun you for the ball if I can...that's just how I roll. My turn-offs are rolled up newspapers and loud noises. I love barking all night when others try to sleep.
  • Purity 5%
  • Age 31 days
  • Racing Exp 1
  • Pitbull terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time15.58 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCGAATCAGCAGGAACCTGAGACCCCTGATCC
T
C
C
G
A
A
T
C
A
G
C
A
G
G
A
A
C
C
T
G
A
G
A
C
C
C
C
T
G
A
T
C
C
Genes: N276AKBILBN

Composition

Pitbull terrier
18%
St. Bernard
18%
Pug
9%
German Shepard
9%
Labrador BK
9%
Dachshund
9%
Maltese
9%
Poodle
9%
Grey Wolf
9%

Current Energy

Vitality +39 points
Lunar Effect -2 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs German Shepard
Front Legs Labrador BK
Head Dachshund
Ears Maltese
Snout St. Bernard
Mouth Poodle
Nose Grey Wolf
Eyes St. Bernard
Color Pitbull terrier

Parents

No Children

Photos