Clancy Cinnamon Bitcoin Game Dog - Mix of Poodle, Border Collie, Dachshund, St. Bernard, Labrador, French Bulldog, Rottweiler, Labrador BK and Grey Wolf

Achievements

Racer
Clancy Cinnamon
I like shaking my fur next to humans right after a good swim! My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! My 'G' spot is under my chin...scratch me there and I'll growl softly. If you are looking for companionship without commitment, keep looking.
  • Purity 3%
  • Age 31 days
  • Racing Exp 8
  • Poodle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time15.42 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGGATACTGACCACGAGACTACCACGCACCC
G
A
C
G
G
A
T
A
C
T
G
A
C
C
A
C
G
A
G
A
C
T
A
C
C
A
C
G
C
A
C
C
C
Genes: IAJB59IJH6L

Composition

Poodle
18%
Border Collie
18%
Dachshund
9%
St. Bernard
9%
Labrador
9%
French Bulldog
9%
Rottweiler
9%
Labrador BK
9%
Grey Wolf
9%

Current Energy

Vitality +13 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Dachshund
Legs Border Collie
Front Legs St. Bernard
Head Labrador
Ears French Bulldog
Snout Poodle
Mouth Border Collie
Nose Rottweiler
Eyes Labrador BK
Color Grey Wolf

Parents

No Children

Photos

Bitcoin dog racing