Coconut Chessie Cryptocurrency Game Dog - Mix of Pitbull terrier, Maltese, Schnauzer, Rottweiler, French Bulldog, St. Bernard, Beagle, German Shepard, Grey Wolf and Dachshund

Achievements

Racer
Coconut Chessie
If you'd like to get together, I'm Coconut Chessie. Ima cyber dog. My favorite treat is to steal the pepperoni off of pizza. I hate going to the vet and will do almost anything to avoid it. Fences are just challenges...I don't let them stop me! I like never worrying about my dog poo. I've got people for that.
  • Purity 1%
  • Age 29 days
  • Racing Exp 6
  • Pitbull terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.73 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCACCATATCCCACCGATGACTATCACCCGGA
T
C
C
A
C
C
A
T
A
T
C
C
C
A
C
C
G
A
T
G
A
C
T
A
T
C
A
C
C
C
G
G
A
Genes: NKCNH9BD7LA

Composition

Pitbull terrier
18%
Maltese
9%
Schnauzer
9%
Rottweiler
9%
French Bulldog
9%
St. Bernard
9%
Beagle
9%
German Shepard
9%
Grey Wolf
9%
Dachshund
9%

Current Energy

Vitality +1 points
Lunar Effect +14 points

Traits Breakdown

Body Pitbull terrier
Tail Maltese
Legs Schnauzer
Front Legs Pitbull terrier
Head Rottweiler
Ears French Bulldog
Snout St. Bernard
Mouth Beagle
Nose German Shepard
Eyes Grey Wolf
Color Dachshund