Barnaby Big Boss Litecoin Game Dog - Mix of Yorkshire Terrier, Pug, Husky, German Shepard, Poodle, Dachshund, Shiba Inu, Labrador BK, Labrador and Corgi

Achievements

Racer
Barnaby Big Boss
You can access my database anytime with your WiFi. I love barking all night when others try to sleep. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I hate it when my humans fart and they blame me! I cry whenever I hear an ambulance siren!
  • Purity 3%
  • Age 3 months
  • Racing Exp 1
  • Yorkshire Terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.35 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAACATCAGACGGAGTAGCACCAAGCTTATTA
G
A
A
A
C
A
T
C
A
G
A
C
G
G
A
G
T
A
G
C
A
C
C
A
A
G
C
T
T
A
T
T
A
Genes: 247IAE65OFF

Composition

Yorkshire Terrier
18%
Pug
9%
Husky
9%
German Shepard
9%
Poodle
9%
Dachshund
9%
Shiba Inu
9%
Labrador BK
9%
Labrador
9%
Corgi
9%

Current Energy

Vitality -29 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Husky
Legs German Shepard
Front Legs Poodle
Head Dachshund
Ears Shiba Inu
Snout Labrador BK
Mouth Labrador
Nose Corgi
Eyes Yorkshire Terrier
Color Yorkshire Terrier