Rayman Rocky Virtual Crypto Dog - Mix of Pug, Grey Wolf, St. Bernard, Yorkshire Terrier, Rottweiler, German Shepard, Schnauzer, Shiba Inu, Labrador and Corgi

Achievements

Racer
Rayman Rocky
Hi! I'm Rayman Rocky! Nyan Cat is my best friend here in the cyberspace. I never met a leg I didn't want to hump. I hate it when my humans fart and they blame me! My favorite game is Fetch except I never bring the ball back. Forget plastic hotdogs...I'm into the classic chew toys like slippers.
  • Purity 1%
  • Age 31 days
  • Racing Exp 1
  • Pug 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.37 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCTGATTAGAACACTCAGAAATAGTACCAAGC
C
C
C
T
G
A
T
T
A
G
A
A
C
A
C
T
C
A
G
A
A
A
T
A
G
T
A
C
C
A
A
G
C
Genes: LBF2H72CE5O

Composition

Pug
18%
Grey Wolf
9%
St. Bernard
9%
Yorkshire Terrier
9%
Rottweiler
9%
German Shepard
9%
Schnauzer
9%
Shiba Inu
9%
Labrador
9%
Corgi
9%

Current Energy

Vitality +10 points
Lunar Effect +4 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Yorkshire Terrier
Front Legs Pug
Head Rottweiler
Ears German Shepard
Snout Pug
Mouth Schnauzer
Nose Shiba Inu
Eyes Labrador
Color Corgi

Parents

No Children

Photos