Lois Luke Digital Cryptocurrency Game Dog - Mix of Labrador BK, German Shepard, Dachshund, Beagle, Pug, St. Bernard, Corgi, Maltese, Boxer and Shiba Inu

Achievements

Racer
Lois Luke
My favorite thing is to sit in my humans' laps while they are trying to read or drive. I hate never catching that damn rabbit in my dreams. Are you into garbage cans? I am. Dragging my butt on the carpet feels so good.
  • Purity 3%
  • Age 3 months
  • Racing Exp 6
  • Labrador BK 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
1 races    Best Time17.02 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGACTAGAATGAGCAGCAAGCACCAACGTA
T
C
A
G
G
A
C
T
A
G
A
A
T
G
A
G
C
A
G
C
A
A
G
C
A
C
C
A
A
C
G
T
A
Genes: 7AD2B66OKGE

Composition

Labrador BK
18%
German Shepard
9%
Dachshund
9%
Beagle
9%
Pug
9%
St. Bernard
9%
Corgi
9%
Maltese
9%
Boxer
9%
Shiba Inu
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Beagle
Front Legs Pug
Head St. Bernard
Ears Labrador BK
Snout Labrador BK
Mouth Corgi
Nose Maltese
Eyes Boxer
Color Shiba Inu